Re: THE CELL LINES HUT102 AND HUT78 17 August 2004
Previous Rapid Response Next Rapid Response Top
Christopher J Noble,
postdoc
Australia

Send response to journal:
Re: Re: THE CELL LINES HUT102 AND HUT78

The Perth Group have previously claimed that control cultures in HIV research are not stimulated.

The Perth Group then cited a paper Science. 1986 Feb 21;231(4740):850-3. which includes several control cultures (not infected with HIV) that are stimulated.

I then said "An honourable person would admit that they have been in error"

The Perth Group have chosen not to admit to any errors despite the evidence that contradicts their claims. They have chosen to deny the evidence.

Let us look at the evidence again.

Table 2

T-cells from normal donors were cultured with and without PHA stimualtion. No RT activity (<1 x10^3 cpm/ml) was seen in the uninfected control cultures with or without PHA stimulation. However when the culture was infected in-vitro with HIV and then stimulated with PHA a measurable RT activity of 46x10^3 cpm/ml was recorded.

Table 3

T-cell cultures showed increased cell death after infection with HIV.

Could the Perth Group please explain these results without simply denying their existence.

The Perth Group also write: HUT-78 was established from a patient with mature T4-cell leukaemia, a disease which Gallo claims is caused by HTLV-1.

For the last time, the group that produced the cell line diagnosed the patient with Sezary Syndrome not ATL. Please read the reference I gave you. Bunn PA Jr, Foss FM, J Cell Biochem Suppl. 1996;24:12-23. Please also read one of the references you have previously cited The untold story of HUT78. If you are still in doubt purchase the cell line. Call lines available from the NIBSC

The Perth Group then seize the opportunity to "publish" a letter that has been rejected by Nature and Science. I wonder if the Perth Group ever consider for a moment that these journals rejected this letter for very good reasons it is full of errors and misrepresentations. Some of these have already been refuted in this "debate".

For instance:1. The human genome contains DNA sequences, sometimes hundreds to thousands, of many retroviral families including HIV sequences.

The references that the Perth Group give show only very small stretches of human DNA that have similarity to HIV sequences for instance Horwitz et al show only two small regions where there is significant similarity.

  
M86246: 1331  agaaatgggtggagagagagacagagacaga 1362   
              ||||   ||||||||||||||||||||||||   
L21352:   42  agaagaaggtggagagagagacagagacaga 72   
              ||||   ||||||||||||||||||||||||   
M15654  7781  agaagaaggtggagagagagacagagacaga 7811  
This is hardly finding HIV in the human genome.

and:Gallo's failure to detect the HIV genome in the T cells of AIDS patients This is associated with the quote In 1994 Gallo stated "We have never found HIV DNA in the tumour cells of KS?In fact we have never found HIV DNA in T-cells". Dishonestly the Perth Group leave out the last part of this quote ", although we've only looked at a few". In fact, Gallo did find HIV DNA in T-cells. This is reported in another of the papers that the Perth Group has already cited.

Competing interests: None declared