Perth Group responses to Brian Foley 25 November 2003
Previous Rapid Response Next Rapid Response Top
Eleni Papadopoulos-Eleopulos,
Biophysicist
Royal Perth Hospital 6001,
Valendar F Turner, John Papadimitriou, Barry Page, David Causer, Helman Alfonso

Send response to journal:
Re: Perth Group responses to Brian Foley

Perth Group responses to Brian Foley

 

In his rapid response "Re: More on Genomic Variability", 1 November, Brian Foley wrote:  "The Perth group wrote:  We don't know how Christopher Noble found only around 18 base pairs similarities between human endogenous sequences and "HIV" sequences.  A few examples will illustrate that this is not the case…They go on to provide 5 so-called examples, none of which show or even claim to show that there are sequences in the human genome that are highly related to HIV-1 or HIV-2 sequences.  The Perth group wrote: "… (i)  In 1985 Weiss and his colleagues reported the isolation, from the mitogenically stimulated T-cell cultures of two patients with common variable hypogammaglobulinaemia, a retrovirus which "was clearly related to HTLV-III/LAV".  Evidence included positive WB with AIDS sera and hybridisation with HIV probes.  (2)" Note that Weiss never claimed that this isolate was either "HIV" or another exogenous retrovirus.

(2) WEBSTER ADB, DALGLEISH AG, BEATTIE R, ET AL

ISOLATION OF RETROVIRUSES FROM TWO PATIENTS WITH "COMMON VARIABLE" HYPOGAMMAGLOBULINEMIA

LANCET 1986; I:581-582"

 

Brian Foley responded:

"The patients described in this paper had received blood transfusions in the USA during the time period before blood was screened for HIV infection.  The discussion in the paper was about whether these patients may have become infected with HIV via those blood transfusions.  The authors indeed did not name the virus "HIV-1" at that time, because at that time HIV-1 was still known as HTLV-III and/or LAV.  The authors did imply that the immune deficiency viruses were exogenous, even if they did not clearly state this.  DNA sequencing was not reported in this paper, so it is impossible to claim that this paper proves that there are DNA sequences in the human genome, with regions longer than 18 bases identical to any HIV-1 isolate sequence".

 

The authors of this paper were from the Clinical Research Centre, Harrow, Middlesex and the Institute of Cancer Research, Chester Beatty Laboratories, London, UK.  One would assume the patients were also from the UK and not the USA.  No mention is made that the patients received "blood transfusions in the USA" or the UK, either "during the time period before blood was screened for HIV infection" or at any other time.  The patients received gammaglobulin treatment however both the gammaglobulin treatment and sexual intercourse were ruled out as causes for HIV infection.  In addition, unlike the AIDS patients and those at risk, the patients described in this study had hypogammaglobulinaemia.  Most importantly, "Both patients' sera were negative for HTLV-III antibodies when tested by means of immunofluorescence against HTLV-III infected cell lines or by competition ELISA".  Nonetheless, "Southern blots of restricted DNA" from the cells of the two patients, "probed with lBH-10" showed "homology to HTLV-III/LAV".

Let us assume that using lBH-10 as a probe, one can obtain a positive hybridisation result even if the human genome contains only "18 bases identical to any HIV-1 isolate sequence" including lBH-10.  The first hybridisation studies with tissue from AIDS patients were conducted by Gallo and his colleagues in 1984.  Using a Southern blot hybridisation technique they tested many tissues from AIDS patients including lymph nodes.  Summarising their finding they wrote, "We have previously been able to isolate HTLV-III from peripheral blood or lymph node tissue from most patients with AIDS or ARC [they "isolated" it from approximately 50% of patients referred to by Gallo]….as shown herein, HTLV-III DNA is usually not detected by standard Southern Blotting hybridisation of these same tissues and, when it is, the bands are often faint….the lymph node enlargement commonly found in ARC and AIDS patients cannot be due directly to the proliferation of HTLV-III infected cells…the absence of detectable HTLV-III sequences in Kaposi's sarcoma tissue of AIDS patients suggests that this tumor is not directly induced by infection of each tumor cell with HTLV-III…the observation that HTLV-III sequences are found rarely, if at all, in peripheral blood mononuclear cells, bone marrow, and spleen provided the first direct evidence that these tissues are not heavily or widely infected with HTLV-III in either AIDS or ARC".1 These studies were confirmed by many other researchers.  The finding that when the results were positive the hybridisation bands were "faint", "low signal" was interpreted as proof that HIV seropositive individuals contain HIV DNA in small numbers of cells and at low copy numbers, an interpretation which became generally accepted, although Gallo and his colleagues had an alternative explanation, "Theoretically, this low signal intensity could also be explained by the presence of virus distantly homologous to HTLV-III in these cells".1  This alternative explanation has been ignored by everybody, including Gallo.  However, at a 1994 meeting held in Washington sponsored by the US National Institute of Drug Abuse, Gallo admitted "We have never found HIV DNA in the tumor cells of KS…In fact we have never found HIV DNA in T-cells".2  This means that in the genome of AIDS patients there are less than "18 bases identical to any HIV-1 isolate sequence".  Furthermore, if it is possible to obtain a positive hybridisation with standard Southern Blotting even if the genome contains "18 bases identical to any HIV-I isolate sequences", this would also be the case with the PCR.  The question then is how does one know that in AIDS patients any positive PCR is due to the presence of "HIV" sequences?

 

Brian Foley wrote:  "The Perth Group wrote:  "DNA extracted from thyroid glands from patients with Grave's disease hybridises with "the entire gag p24 coding region" of "HIV". (3)" 

(3) Ciampollio A, Marini V, Buscema M (1989)  Retrovirus-like sequences in Grave's disease: Implications for human autoimmunity. 

Lancet i:1096-1100"

 

He responded:

"The fact that under low stringency conditions, the HIV-1 gag p24 coding region hybridises to some human DNA, again does not mean that there is any segment of DNA in the human genome, longer than 18 bp that is identical to the sequence of any isolate of HIV-1".

 

To avoid any misunderstanding, let us quote from the paper:  "None of the patients had detectable antibodies to human immunodeficiency virus type 1 (HIV-1) or human T-lymphotropic virus type 1….Grave's thyroid DNAs were tested with a 949 bp HIV-1 fragment with coordinates 692-1641 (Pvu II-Bgl II, isolated from lBH-10).  Both fragments represented the entire gag p24 coding region of the HIV-1 genome….Blots were hybridised according to the commercial protocol with the 32P-labelled probe at 65°C (Multiprime labelling system, Amersham).  They were then washed in high stringency conditions (2 x standard saline citrate [SSC] 15 min, 65°c, twice;  2 x SSC 0.1% sodium dodecyl sulphate, 30 min, 65°C;  0.1 x SSC, 20 min, 65°C) and autoradiographed on hyperfilms (Amersham) at -70°C for at least one week, with intensifying screens".  

 

Brian Foley further wrote:  "The Perth Group wrote:  "In a study designed to address the question whether the neuronal cells of patients with AIDS dementia complex are infected with "HIV", "the brains from 10 patients with AIDS and neurological evidence of viral encephalitis and the brains from 5 patients without HIV-1 infection" were examined using an HIV gag probe.  "The antisense riboprobe hybridised to cells known to be infected with HIV-1.  It hybridised to HIV-1 infected A3.O1 cells as well as splenic and renal lymphocytes obtained at autopsies from patients known to have AIDS.  The probe did not, however, hybridise to neurones in the brain sections from 10 patients with AIDS…Surprisingly, when we applied the control sense HIV-1 gag probe to the brain sections from patients with AIDS, we observed specific hybridisation to neuronal cells.  Similarly, when brain sections from five individuals not infected with HIV-1 were examined, the HIV-1 sense probe detected transcripts in neuronal cells.  Our Northern blot analysis confirmed these results and demonstrated the presence of a 9.0-kb polyadenylated transcript to brain tissues". (4)  The authors concluded that there is a neurone-specific 9.0-kb transcript that shows extensive homology with antisense gag "HIV-1" sequences and that this transcript is expressed in neuronal cells of both "HIV-1" - infected and noninfected individuals".

            (4)  Wu TC, Kanayama MD, Hruban RH, Whitehead W, Raj BK (1993)

Detection of a neuron-specific 9.0-kb transcript which shares homology with antisense transcripts of HIV-1 gag gene in patients with and without HIV-1 infection.

            Am J Pathol 142:25-31"

 

Brian Foley responded:  "There is no such thing as "extensive homology".  Sequences are either homologous, meaning they are derived from a common ancestor, or they are not.  The authors clearly misused the terms "homology" and "homologous" where they should have used the terms similarity and similar.  Again, finding a bit of DNA or RNA that will hybridise to another bit of DNA or RNA under low stringency conditions does not indicate that the two sequences are identical". 

 

There can be homologous sequences without necessarily deriving from the same common ancestor.  "Homologous genes are genes in different species that share similar structures and functions…..Homologies:  Similarities in DNA or protein sequences" (www.MedicineNet.com).  In other words, homologous is synonymous with similar.

As far as the "low stringency conditions", let us quote what the authors of the study said:  "The specificity of this hybridisation was further ascertained by increasing the stringency of washing conditions.  Melting of the hybridisation signal of the HIV-1 gag sense probe was proportional to the melting of ribosomal RNA hybridisation signal when the temperature of the wash was progressively raised from 65 C to 85 C.  These results suggest an extensive nucleotide sequence homology of this neuronspecific transcript to antisense HIV-1 gag sequences".

 

Brian Foley wrote:  "The Perth Group wrote:  "Horowitz et al, described the first report of the presence of nucleotide sequences related to "HIV-1" in human, chimpanzee and Rhesus monkey DNAs from normal uninfected individuals.  They have "demonstrated the presence of a complex family of HIV-1 related sequences" in the above species, and concluded that "Further analysis of members of this family will help determine whether such endogenous sequences contributed to the evolution of HIV-1 via recombination events or whether these elements either directly or through protein products, influence HIV pathogenesis".(5)"

(5) Horwitz MS, Boyce-Jacino MT, Faras A (1992)

Novel human endogenous sequences related to human immunodeficiency virus type 1.   J Virol 66:2170-2179"

 

Brian Foley responded:  "The sequences reported by Horwitz et al are located in GenBank entries with accession numbers M85292 and M86246.  Neither one of those two sequences is highly related to any isolate of HIV-1, HIV-2 or any other lentivirus.  One of them however (M86246) does indeed contain a sequence of 21 DNA bases identical to 21 bases in the HIV-1 M group subtype B clone BH10 with accession number M15654:

 

M86246 :         1331    agaaatgggtggagagagagacagagacaga            1362

                                                 x x x x     x x x x x x x x x x x x x x x x x x x x x x x x

            L21352  :             42    agaagaaggtggagagagagacagagacaga           72

                                                 x x x x     x x x x x x x x x x x x x x x x x x x x x x x x

            M15654  :        7781    agaagaaggtggagagagagacagagacaga           7811

 

This is a region of the HIV-1 genome near the end of the second exon of Tat, and you will note that the region if of low complexity, with many "AG" dinucleotide repeats.  Other than this small region, the two human sequences reported by Horwitz et al are not close to identical to any isolate of any lentivirus.  They do share the property of lentiviral DNA of being A-rich and C-poor.  M86246 is 30.4% A, 17.6% C, 23.4% G and 28.7% T which is not quite as extremely A-rich as the base composition of lentiviral DNA (39% A, 16.5% C, 22.7% G and 21.8% T)".

 

In the Horowitz et al paper one reads:  "We have previously used reduced-stringency hybridisation conditions to allow us to detect novel endogenous retroviruses exhibiting as little as 65% sequence similarity to the retroviral…Herein we described the first report of the presence of nucleotide sequences related to HIV-1 in human, chimpanzee and rhesus monkey DNAs from normal uninfected individuals.  We also present the isolation and characterisation of two of these endogenous HIV-1 related sequences, EHS-1 and EHS-2…..Analysis of EHS-1 revealed a region of about 100 bp with 70 to 80% similarity to HIV-1 env…..Sequence analysis of EHS-2 revealed a stretch of 28 of 31 bp of nucleic acid identity to HIV-1 across the overlapping  reading frames of Rev and gp41…..Additionally, a downstream region of 50 bp of EHS-2 has about 60% nucleic acid similarity to a downstream region of rev and env (gp41)….. The putative gene product of EHS-1 is similar to that of HIV-1 in the structure, size, spacing and basic residue content across this region…..EHS-2 may encode a gene product similar in function to HIV-1 Rev".

 

Brian Foley wrote:  "The Perth Group wrote:  "In a 1993 study, in one kidney recipient (the donor was negative for p24 antigen) who, 3 days following transplantation developed fever, weakness, myalgias, cough and diarrhoea, all "Bacteriological, parasitological and virological samples remained negative.  The only positive result was antigenaemia p24, positive with Abbot antigen kits in very high titers of 1000 pg/ml for polyclonal and 41pg/ml for monoclonal assays.  This antigenaemia was totally neutalizable with Abbot antiserum anti-p24…2 months after transplantation, all assays for p24-antigen became negative, without appearance of antibodies against HIV.  Five months after transplantation our patient remains asymptomatic, renal function is excellent, p24 antigenaemia till negative and HIV antibodies still negative". (6)  Using two kits, the Abbot and Diagnostic Pasteur, in one study, p24 was detected transiently in 12/14 kidney recipients.  Peak titres ranged from 850 to 200 000 pg/ml 7-27 days post-transplantation.  Two heart and 5/7 bone marrow recipients were also positive, although the titres were lower and ranged from 140-750 pg/ml.  Disappearance of p24 took longer in kidney (approximately 6 months) than in bone-marrow (approximately 4-6 weeks) recipients.  Discussing their findings the authors wrote:  "The observation of a 25-30kD protein binding to polyclonal anti-HIV human sera after immunoblots with reactive sera raises several questions…The 25-30kD protein could therefore be compared with the p28 antigen recently described with human T-cell-related virus lymphotropic-endogenous sequence…The characterisation of this 25-30kD protein may represent an important contribution to the detection of HIV-1-related endogenous retroviruses". (7)" 

(6) Vincent F, Belec L, Glotz D, Menoyo-Calonge V, Duboust A, Bariety J. (1993)

False-positive neutalizable HIV antigens detected in organ transplant recipients.

AIDS 7:741-742.

(7) Agbalika F, Ferchal F, Garnier JP, Eugene M, Bedrossian J, Lagrange PH (1992)

False-positive HIV antigens related to emergence of a 25-30kD proteins detected in organ recipients.   AIDS 6:959-962".

 

Brian Foley responded:  "Again these authors are not presenting any evidence that there is any segment of DNA in the human genome longer than about 18 bases that is identical to any isolate of HIV-1 or any other lentivirus". 

 

The authors of these studies presented as much evidence for the presence of "HIV" p24 in the transplant patients as any "HIV" expert for its presence in AIDS patients.

If the protein in the AIDS patients is coded by the "HIV" gag gene then the same gene, the whole gene, and not only 18 or less bases must be present in the transplant recipients.

 

Brian Foley wrote:  "The human genome contains hundreds of endogenous retroviruses and retroviral-like repetitive elements.  None of them are closely related to any lentivirus…..None of the endogenous retroviruses in the human genome are closely related to any lentivirus". 

 

We find it difficult to understand the relevance of this to the present discussion.  The absence of lentiviruses or even any other endogenous retrovirus does not preclude the presence in the human genome of sequences similar to the "HIV" sequences.

 

In his rapid response "The Politics of AIDS in South Africa", 6 November, Brian Foley wrote:  "On Nov 4th, the Perth group wrote:  "…Would Christopher Noble please tell us what evidence "databases of genetic sequences and phylogenetic trees" give us regarding the existence of a virus?  We have always thought that to prove the existence of the :HIV" virus, you have to isolate/purify it and then proceed to define its genome and genomic sequences and its proteins.  Otherwise, how do you know that the genomic sequences are those of "HIV" and the proteins are coded by these sequences?  It is obvious that you cannot start with impure material to define the origin of the genome.  If Christopher Noble has another way would he please tell us what it is?...We have repeatedly told you that you thought wrong.  No organism has ever been "purified" 100%, no virus has ever been "isolated" by the full criteria which you have designed to be impossible.  The study of microorganisms has never involved 100% "purity" and "isolation" from all other living and non-living matter, and it never will.  Separation techniques, such as passing a culture supernatant through a series of filters with progressively smaller pore sizes tells us if a pathogen is cell--sized (fungi, protist, cancer cell, etc) bacteria-sized, or virus-sized.  It is not necessary to show that the filtrate is 100% "pure", only that the pathogen is in the filtrate.  After size is determined, other methods such as serology and genomic sequencing can be employed to determine which component found in the infectious filtrate is the pathogen".

 

Let us repeat once again, the criteria for isolation/purification are not ours but those of some of the most eminent retrovirologists including Barre-Sinoussi and Chermann.  In all this debate we have been asking for evidence which proves the existence of an agent, HIV.  Brian Foley is talking about evidence which proves that an agent is pathogenic.  The two are not the same thing.

 

To prove the existence of a new unique virus one must have proof (i) for the existence of virus-like particles;  (ii) that the particles are infectious;  (iii) that the particles have unique nucleic acids and proteins.  If it is not possible to obtain isolated/purified particles or at least particles isolated from everything else which also has nucleic acids and proteins then how is it possible to prove the existence of viral RNA and protein and thus of the virus?  Would Brian Foley tell us how were the "HIV" proteins (antigens) and nucleic acids (probes and primers) presently used in "methods such as serology and genomic sequencing" obtained?

 

No information regarding the pathogenic effects of an agent can be obtained by simply determining it's size.  If Brian Foley causes a disease by the administration of a filtrate which is not pure, that is, it contains more than one agent, how would he know which one of them is the pathogen?

 

That this is not possible, even when the additional agents are too small to be visualised, was stressed by Peyton Rous as far back as 1911.  In that year he was able to repeatedly induce tumours in chickens by means of tumour derived cell free filtrates.  Regarding the pathogen in the filtrate he wrote: "The first tendency will be to regard the self‑perpetuating agent active in this sarcoma of the fowl as a minute parasitic organism.  Analogy with several infectious diseases of man and the lower animals, caused by ultramicroscopic organisms, gives support to this view of the findings, and at present work is being directed to its experimental verification.  But an agency of another sort is not out of the question.  It is conceivable that a chemical stimulant, elaborated by the neoplastic cells, might cause the tumour in another host and bring about in consequence a further production of the same stimulant".3

 

Brian Foley wrote:  "It was very clear by 1982, from conventional epidemiology, such as contact tracing of sex partners, needle sharing partners and blood donors, that AIDS was caused by a pathogen that was transmitted only by close contact and not be casual contact.  It remains clear today that AIDS is not caused solely by environment factors or toxins or malnutrition, even if other health problems somewhat similar to AIDS are sometimes caused by such factors (1-23)".

 

In none of the 23 references which Brian Foley cited is there any evidence, much less proof, that AIDS was caused by an infectious agent.  We welcome Brian Foley's admission that "health problems somewhat similar to AIDS are sometimes caused" by "environmental factors or toxins or malnutrition".  The problem is how one can tell when the "health problems" are caused by all these other factors and when they are caused by an infectious agent. As Brian knows the history of Medicine demonstrates this is not a trivial problem.  Often it takes many decades to arrive at the facts.  For example, it was once thought that individuals suffering from both scurvy and pellagra could transmit these diseases to others.  Much scientific research and debate, (accompanied by considerable polemics) were needed to finally resolve the pathological basis of these conditions.4 5

 

Brian Foley wrote:  "When a DNA sequence is determined from an organism, now that the DNA sequences of tens of thousands of organisms have been deposited in electronic databases, it is usually trivial to determine what type of organism the new DNA sequence is derived from".

 

Would Brian Foley tell us how and by what methods were the first DNA sequences deposited in the electronic databases for each of the tens of thousands of organisms obtained?

 

Brian Foley wrote:  "Serology and DNA sequencing alone are often sufficient to get started until complete infectious molecular clones or other materials become available for confirmatory work".

 

To perform "serology and DNA sequencing" one needs specific viral antigens and probes and primers.  Would Brian Foley tell us how and by what method they are obtained?

 

Brian Foley wrote:  "Not only is your full procedure not necessary, it is impossible…The Perth Group has been repeatedly informed that they are deluded in their beliefs about the techniques and procedures used to study viruses".

 

We repeat yet again, these are not our techniques and procedures but those of some of the best known retrovirologists and "HIV" experts.  And in fact they are common sense.  Perhaps Brian Foley would like to write to these experts and tell them they are wrong.

 

Brian Foley wrote:  "Yet they continue to repeat the same rhetoric, as if repetition will make it more true.  The subject of these rapid responses is not the "isolation" of HIV, but the "The politics of AIDS in South Africa: beyond the controversies".  This non peer reviewed exchange cannot and will not have any impact whatsoever on viral research, nor setting ground rules for genomics.  This discussion can only have a small impact on uncovering the thinking that has lead the Perth Group to attempt to misinform the government of South Africa about what it should do to mitigate the AIDS epidemic in that country.  The Perth groups' use of quotes about influenza and polio viruses, show that they are not ignorant of all aspects of virology.  Instead they are quite clever about selecting titbits of information in an attempt to support their ideology.  It is my opinion that the South African government should have set rules for the discussion of HIV and AIDS by their panel (such as rules stipulating that the participants tell the truth, the whole truth and nothing but the truth) and established penalties for breaking those rules.  Without any such rules and penalties, in the South African panel discussion or here in Rapid Responses, there can be no expectation of a credible or fair outcome.  This does not mean that such panels and discussions are worthless, but it does place some constraints on their usefulness".

 

How is it possible for us to have such an influence with the President of  South Africa and his Government when we have so little with the scientific community?

 

Brian Foley wrote:  For my own part in this, I feel I must clear up at least one point that I was incorrect or misleading on above:

The Bess et al result of  a ratio of 150:1 was indeed from a cell line that does not express the HLA DR gene, the best result with an HLA DR-producing cell reported by Bess was 119:1.  But it should also be noted that the ratio is based on the sum of both HLA DR and Beta 2 microglobulin, and not just HLA DR as the header of the figure (p24 to HLA ratio) might imply.  None of that has anything to do with "proof" of the existence of HIV, it only shows that reagents made from density gradient ultracentrifugation and fractionation contain human proteins both from the cellular envelope (which surrounds all enveloped viruses) and from extra-viral material in the form of cellular vesicles and debris.  For that reason, other methods of purification of viral proteins, such as cloning viral genes for protein production in bacteria, may sometimes be necessary of desirable".

 

If the "density gradient ultracentrifugation and fractionation contain human proteins both from the cellular envelope…and from extra-viral material in the from of cellular vesicles and debris" how can anyone prove which of the proteins present there are "HIV" and which are cellular?  How, from such a material which, as Bess has shown contains cellular poly(A)-RNA, could anyone obtain the "HIV" genes for protein production in bacteria?

 

In his rapid response "Mutations in HIV proteins do indeed sometimes alter function", 8 November, Brian Foley wrote:  "The Perth Group wrote:  "As far as the effect of protein variability on their function is concerned, let us quote from a recent article published in Nature  "Small genetic variations between people - or polymorphisms - can alter the behaviour of proteins that carry a drug to its target cells or tissues, cripple the enzymes that activate a drug or aid its removal from the body, or alter the structure of the receptor to which a drug is supposed to bind.  Variation in immune-system genes can also influence how particular drugs are tolerated.  Together, these subtle genetic variations mean that the dose at which a drug will work may vary hugely from person to person.  And with today's 'one-size-fits-all' prescribing, that can lead to life-threatening adverse reactions or to a drug completely failing to do its job.  Yet the genomics revolution has given us the tools to identify people who don't fit the standard prescribing mould.  Single nucleotide polymorphisms, or SNPs, are single-letter changes in the genetic code that are scattered throughout the genome.  They can now be profiled with increasing efficiency, and use to highlight polymorphic genes that influence our response to individual drugs". (1)"

(1) (2003) Nature 425:760-762”.

 

He responded: “That paper states that single nucleotide polymorphisms "CAN" result in one or more of these effects.  It does not state that every single nucleotide change DOES result in a functional change.  It is true that some single base changes in DNA result in a change in the amino acid encoded by a gene, these are called nonsynonymous mutations.  It has been well established that some nonsynonymous mutations in HIV-1 M group subtype B viruses are highly selected by antiretroviral monotherapy.  For one example, monotherapy with zidovudine (AZT) rapidly proved to be of almost no long-term benefit to patients, despite its obvious short-term benefits, because of this type of drug-resistance mutation".

 

We are glad that Brian Foley agrees with us that protein variability could lead to changes in functions.  We have never claimed "that every single nucleotide change DOES result in a functional change".

 

Brian Foley wrote:  "The Perth Group wrote:  "Would Christopher Noble please tell us:   (i)            Where is the proof that "HIV" strains have diverged over time?"

 

Here are a few of the hundreds of papers on that topic". 

 

Before one can debate how the "HIV" strains "have diverged over time" it is absolutely necessary to have proof for the existence of the "HIV" genome.  We have repeatedly asked Brian Foley how the existence of the “HIV” genome was proven but he has never given any answers.   We find it difficult to understand why Brian Foley answers the questions we put to Christopher Noble but not the many basic questions we put to him.

 

Brian Foley wrote:  "The Perth Group wrote:  "As far back as 1989-1992 when the "extraordinary variability" of the "HIV" genome was not known, researchers from the Pasteur Institute including Wain-Hobson were of the opinion that: "The task of defining HIV infection in molecular terms will be difficult" (5,6)"

(5) Vartanian JP, Meyerhans A, Henry M, Wain-Hobson S. (1992)

High-resolution structure of an HIV-1 quasispecies: identification of novel coding sequences.  AIDS 6(10): 1095-1098.

(6) Meyerhans A, Cheynier R, Albert J, Seth M, Kwok S, Sninsky J, et al (1989)

Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HIV isolations.  Cell 58(5): 901-910.

In fact, much was known about the variability and diversity of HIV-1, HIV-2 and several simian immunodeficiency viruses by the 1989-1992 time period.  Reference 5 does not mention anything about a difficulty in defining HIV infection.  Reference 6 makes that statement in the abstract, when discussing how difficult it is to describe, in molecular terms, the entire repertoire of virions present in at any one time within the viral quasispecies of a single infected host.  He was most certainly not saying that it is difficult to determine or define whether or not a given patient is infected.

Here are a few papers which show that the diversity of HIV-1, HIV-2 and a few SIVs were well established by 1992".

 

We have never said that the "diversity of HIV-1" was not known before 1992.  That "HIV-1" is not a unique virus, that is, that it does not have a unique genome has been known from the time the first "HIV-1" gene have been described, and even before that.  The term used in Gallo's 1984 papers where the "isolation" of "HIV" was described, is "viruses" not virus.  However, the "extraordinary variability" became known only later.6

 

The French researchers did say that it would be "difficult to determine or define [in molecular terms] whether or not a given patient is infected".  Since then, this has been accepted by many HIV experts and by the CDC (see our most recent rapid response to Christopher Noble).

 

 

References

 

 

1. Shaw GM, Hahn BH, Arya S, Groopman JE, Gallo RC, Wong-Staal F. Molecular characterization of human T-cell leukemia (lymphotropic) virus type III in the acquired immune deficiency syndrome. Science 1984;226:1165-1171.

2. Lauritsen JL. NIDA meeting calls for research into the poppers-Kaposi's sarcoma connection. In: Duesberg PH, editor. AIDS: Virus- or Drug Induced. London: Kluwer Academic Publishers, 1995:325-330.

3. Rous P. A Sarcoma of the Fowl transmissible by an agent separable from the Tumor Cells. J Exp Med 1911;13:397-411.

4. Brown SR. Scurvy. Melbourne: Penguin, 2003.

5. Elmore JG, Feinstein AR. Joseph Goldberger: An unsung hero of American clinical epidemiology. Ann Int Med 1994;121:372-375.

6. Korber B, Gaschen B, Yusim K, Thakallapally R, Kesmir C, Detours V. Evolutionary and immunological implications of contemporary HIV-1 variation. British Medical Bulletin 2001;58:19-42.

 

Competing interests: None declared