Re: More On Genomic Variability 1 November 2003
Previous Rapid Response Next Rapid Response Top
Brian T Foley,
HIV Researcher
Los Alamos National Lab, Los Alamos, NM 87545

Send response to journal:
Re: Re: More On Genomic Variability

The Perth group wrote:
“...
We don’t know how Christopher Noble found only around 18 base pairs similarities between human endogenous sequences and “HIV” sequences. A few examples will illustrate that this is not the case:
...”

They go on to provide 5 so-called examples, none of which show or even claim to show that there are sequences in the human genome that are highly related to HIV-1 or HIV-2 sequences.

The Perth group wrote:
“... (i) In 1985 Weiss and his colleagues reported the isolation, from the mitogenically stimulated T-cell cultures of two patients with common variable hypogammaglobulinaemia, a retrovirus which "was clearly related to HTLV-III/LAV". Evidence included positive WB with AIDS sera and hybridisation with HIV probes.(2) Note that Weiss never claimed that this isolate was either “HIV” or another exogenous retrovirus.
(2) WEBSTER ADB, DALGLEISH AG, BEATTIE R, ET AL.
ISOLATION OF RETROVIRUSES FROM TWO PATIENTS WITH "COMMON VARIABLE" HYPOGAMMAGLOBULINEMIA.
LANCET 1986;I:581-582.
...”

The patients described in this paper had recieved blood transfusions in the USA during the time period before blood was screened for HIV infection. The discussion in the paper was about whether these patients may have become infected with HIV via those blood transfusions. The authors indeed did not name the virus “HIV-1” at that time, because at that time HIV-1 was still known as HTLV-III and/or LAV. The authors did imply that the immune deficiency viruses were exogenous, even if they did not clearly state this.

DNA sequencing was not reported in this paper, so it is impossible to claim that this paper proves that there are DNA sequences in the human genome, with regions longer than 18 bases identical to any HIV-1 isolate sequence.

The Perth group wrote:
“... (ii) DNA extracted from thyroid glands from patients with Grave's disease hybridises with "the entire gag p24 coding region" of “HIV”.(3) (3) Ciampollio A, Marini V, Buscema M. (1989)
Retrovirus-like sequences in Grave's disease: Implications for human autoimmunity.
Lancet i:1096-1100.
...”

The fact that under low stringency conditions, the HIV-1 gag p24 coding region hybridizes to some human DNA, again does not mean that there is any segment of DNA in the human genome, longer than 18 bp that is identical to the sequence of any isolate of HIV-1.

The human genome contains hundreds of endogenous retroviruses and retroviral-like repetitive elements. None of them are closely related to any lentivirus.

The Perth group wrote:
“... (iii) In a study designed to address the question whether the neuronal cells of patients with AIDS dementia complex are infected with “HIV”, "the brains from 10 patients with AIDS and neurological evidence of viral encephalitis and the brains from 5 patients without HIV-1 infection" were examined using an HIV gag probe. "The antisense riboprobe hybridized to cells known to be infected with HIV-1. It hybridised to HIV-1 infected A3.O1 cells as well as splenic and renal lymphocytes obtained at autopsies from patients known to have AIDS. The probe did not, however, hybridize to neurones in the brain sections from 10 patients with AIDS...Surprisingly, when we applied the control sense HIV-1 gag probe to the brain sections from patients with AIDS, we observed specific hybridization to neuronal cells. Similarly, when brain sections from five individuals not infected with HIV-1 were examined, the HIV-1 sense probe detected transcripts in neuronal cells. Our Northern blot analysis confirmed these results and demonstrated the presence of a 9.0-kb polyadenylated transcript in brain tissues".(4) The authors concluded that there is a neurone-specific 9.0- kb transcript that shows extensive homology with antisense gag “HIV-1” sequences and that this transcript is expressed in neuronal cells of both “HIV-1”- infected and noninfected individuals.
(4) Wu TC, Kanayama MD, Hruban RH, Whitehead W, Raj BK. (1993)
Detection of a neuron-specific 9.0-kb transcript which shares homology with antisense transcripts of HIV-1 gag gene in patients with and without HIV-1 infection.
Am J Pathol 142:25-31.
...”

There is no such thing as “extensive homology”. Sequences are either homologous, meaning they are derived from a common ancestor, or they are not. The authors clearly misused the terms “homology” and “homologous” where they should have used the terms similarity and similar. Again, finding a bit of DNA or RNA that will hybridyzed to another bit of DNA or RNA under low stringency conditions does not indicate that the two sequences are identical. None of the endogenous retroviruses in the human genome are closely related to any lentivirus.

The Perth group wrote:
“... (iv) Horowitz et al, "describe the first report of the presence of nucleotide sequences related to “HIV-1” in human, chimpanzee and Rhesus monkey DNAs from normal uninfected individuals". They have "demonstrated the presence of a complex family of HIV-1 related sequences" in the above species, and concluded that "Further analysis of members of this family will help determine whether such endogenous sequences contributed to the evolution of HIV-1 via recombination events or whether these elements either directly or through protein products, influence HIV pathogenesis".(5)
(5) Horwitz MS, Boyce-Jacino MT, Faras A. (1992)
Novel human endogenous sequences related to human immunodeficiency virus type 1.
J Virol 66:2170- 2179.
...”

The sequences reported by Horwitz et al are located in GenBank entries with accession numbers M85292 and M86246. Neither one of those two sequences is highly related to any isolate of HIV-1, HIV-2 or any other lentivirus. One of them however (M86246) does indeed contain a sequence of 21 DNA bases identical to 21 bases in the HIV-1 M group subtype B clone BH10 with accession number M15654:

M86246: 1331  agaaatgggtggagagagagacagagacaga 1362 
              ||||   |||||||||||||||||||||||| 
L21352:   42  agaagaaggtggagagagagacagagacaga 72 
              ||||   |||||||||||||||||||||||| 
M15654  7781  agaagaaggtggagagagagacagagacaga 7811

This is a region of the HIV-1 genome near the end of the second exon of Tat, and you will note that the region is of low complexity, with many “AG” dinucleotide repeats.

Other than this small region, the two human sequences reported by Horwtiz et al are not close to identical to any isolate of any lentivirus. They do share the property of lentiviral DNA of being A-rich and C-poor. M86246 is 30.4% A, 17.6%C, 23.4% G and 28.7% T which is not quite as extremely A-rich as the base composition of lentiviral DNA (39%A, 16.5% C, 22.7% G and 21.8% T)

Regardless, the authors never claim to have found HIV DNA in the human genome, they only claim to have found some DNA that hybridizes to HIV at low stringency.

The Perth group wrote:
“... (v) In a 1993 study, "In one kidney recipient (the donor was negative for p24 antigen) who, 3 days following transplantation developed fever, weakness, myalgias, cough and diarrhoea, all "Bacteriological, parasitological and virological samples remained negative. The only positive result was antigenaemia p24, positive with Abbot antigen kits in very high titers of 1000pg/ml for polyclonal and 41pg/ml for monoclonal assays. This antigenaemia was totally neutalizable with Abbot antiserum anti-p24...2 months after transplantation, all assays for p24-antigen became negative, without appearance of antibodies against HIV. Five months after transplantation our patient remains asymptomatic, renal function is excellent, p24 antigenaemia still negative and HIV antibodies still negative".(6) Using two kits, the Abbot and Diagnostic Pasteur, in one study, p24 was detected transiently in 12/14 kidney recipients. Peak titres ranged from 850 to 200 000 pg/ml 7-27 days post- transplantation. Two heart and 5/7 bone marrow recipients were also positive, although the titres were lower and ranged from 140-750 pg/ml. Disappearance of p24 took longer in kidney (approximately 6 months) than in bone-marrow (approximately 4-6 weeks) recipients. Discussing their findings the authors wrote: "The observation of a 25-30kD protein binding to polyclonal anti- HIV human sera after immunoblots with reactive sera raises several questions...The 25-30kD protein could therefore be compared with the p28 antigen recently described with human T-cell- related virus lymphotropic- endogenous sequence...The characterization of this 25-30kD protein may represent an important contribution to the detection of HIV-1-related endogenous retroviruses".(7)
(6) Vincent F, Belec L, Glotz D, Menoyo-Calonge V, Duboust A, Bariety J. (1993)
False-positive neutralizable HIV antigens detected in organ transplant recipients.
AIDS 7:741-742.
(7) Agbalika F, Ferchal F, Garnier JP, Eugene M, Bedrossian J, Lagrange PH. (1992)
False-positive HIV antigens related to emergence of a 25-30kD proteins detected in organ recipients.
AIDS 6:959-962.
...”

Again these authors are not presenting any evidence that there is any segment of DNA in the human genome longer than about 18 bases that is identical to any isolate of HIV-1 or any other lentivirus.

The Perth group has been repeatedly informed that lentiviruses are complex exogenous retroviruses and that no complex retrovirus has ever been found in any animal in an endogenous state. Of the viruses discovered to date, the most closely related to the lentiviruses are the primate T cell leukemia viruses, which are also complex and never found to be endogenous. Of the endogenous retroviruses discovered to date, the one most closely related to lentiviruses is the HERV-K. This has all been published by Michael Tristem in several papers such as:

Tristem M.
Identification and characterization of novel human endogenous retrovirus families by phylogenetic screening of the human genome mapping project database.
J Virol. 2000 Apr;74(8):3715-30.
PMID: 10729147
Herniou E, Martin J, Miller K, Cook J, Wilkinson M, Tristem M.
Retroviral diversity and distribution in vertebrates.
J Virol. 1998 Jul;72(7):5955-66.
PMID: 9621058

Competing interests: None declared