Re: More On Genomic Variability 24 October 2003
Previous Rapid Response Next Rapid Response Top
Christopher J Noble,
postdoctoral fellow
Bern Switzerland

Send response to journal:
Re: Re: More On Genomic Variability

Eleni Papadopulos-Eleopulos writes: "In his reference 1: (i) the authors compared not only human influenza A viruses but also influenza A viruses of birds obtained at different times from around the world (A/Turkey/Ontario/6118/68, A/Duck/Alberta/60/76, A/Gull/Maryland/704/77, A/Duck/Czechoslovakia/58, A/Shearwater/Australia/1/72, A/Turkey/Wisconsin/66, A/Duck/England/56, A/Duck/Ukraine/1/63, A/Tern/South Africa/61) (This is the same as comparing "HIV-1", "HIV-2", "SIV" and other animal immunodeficiency viruses such feline); (ii) the sequence differences were based upon several assumptions. "

I have already provided with a number of examples of human influenza A hemagglutinins that differ by approximately 50%. I cannot understand how you can continue to deny simple facts.

Eleni Papadopulos-Eleopulos writes: "Since the topic of this debate is still "HIV", it is not sufficient to just look at databases and phylogenetic trees and the existence/non- existence of a given virus cannot be either proven or disproven by another virus, our answer remains the same. "

It may not be sufficient to look at databases of genetic sequences and phylogenetic trees of these sequences to discuss the existence of a virus. However, it is absolutely essential to look at this evidence - ALL of the evidence including genome sequences. The fact that you continue to ignore this evidence only demonstrates why you are often referred to as a "Denialist". You deny the evidence. The ironic thing is that you have specifically referred to the genetic sequences of influenza A and poliovirus in an attempt to disprove the existence of HIV. Now you are doing your best to avoid the issue. You brought up the issue of the genome of influenza A and poliovirus not me.

Your "answer" remains the same. You simply refuse to look at evidence that contradicts your beliefs.

Eleni Papadopulos-Eleopulos writes: "Let us again reiterate that the 1% variability is not our claim but that of a number of virologists."

No, it is not the view of a number of virologists. You are either deliberately or through ignorance conflating several completely different aspects of RNA virus genomes.

In the case of HIV you talk about the genetic difference between highly divergent strains. These strains have diverged over time just as strains of influenza A and poliovirus diverge over time.

In other cases you refer to the variation in a quasispecies in an individual at a given time.

These are fundamentally different things. The fact that you continue to tlak about these two things interchangeably suggests to me that either you do not understand what you read in these papers or that you are deliberately attempting to mislead readers.

Eleni Papadopulos-Eleopulos writes: "Regarding how loose the leash can be, we felt that Christopher Noble would consider more readily the views of eminent virologists such as Robert Gallo, Peter Duesberg, Esteban Domingo and researchers from the Pasteur Institute rather than ours. That is why we gave their views in our rapid response "Genomic Variability" (14th October 2003). If Christopher Noble disagrees with their views, perhaps he may try to convince them to change their views and rewrite virology. "

I do not disagree with the views of these researchers. I disagree with your misrepresentation of their views. They do not agree with you. These researchers have never, ever said "the genomes of RNA viruses do not differ by more than 1%". You are the one that has made this claim.

Eleni Papadopulos-Eleopulos writes: "In the same paper, one reads: "amino acid sequence homology within a serotype is 80% or more even between virus strains readily distinguishable by polyclonal antibodies?substitution of a single amino acid out of five to six residues which usually make up an antigenic determinant may profoundly alter the antigenicity?". (1)

So protein variability does lead to functional and antigenic variations. That this is the case, one need look no further than the sickle cell syndromes"

Huh? Where was functional variation mentioned? You don't appear to understand the citation you have given. You do mention an important aspect. The antigenicity of a protein is determined by only a few, five or six, amino acids. This is a small proportion of the amino acids in a protein such as HIV gp41. Substitutions in the rest of the protein that do not affect this epitope will not affect the antigenicity. Hence conserved epitopes are important for both antibodies tests and possible vaccines.

Eleni Papadopulos-Eleopulos writes: "Christopher Noble may be able to convince these virologists that amino acid polymers having variations of 60%, 81% or even 100% represent the same protein which perform the same function, can be detected by the same antibody test, can be considered to be the same constituent of a viral particle which can be neutralized by vaccines to this protein. He may also be able to convince them that if there is a 60% change in their proteins, they will still be Peter Duesberg, Robert Gallo, Esteban Domingo, Wain-Hobson, they will still look the same and perform the same functions. Then he may be able to rewrite not only virology and molecular biology but also biology. "

I have never said amino acid polymers having variations of 60%, 81% or even 100% can be detected by the same antibody test. Please retract this at once. This is not the first time you have misrepresented my statements. This claim is purely your invention. I have been consistently arguing that divergent strains of HIV cannot be detected with antibody tests that use only one set of antigens. To detect divergent strains of HIV like HIV-1 group O you need to include HIV-1 group O antigens in the antibody test.

Eleni Papadopulos-Eleopulos writes: "We don't know how Christopher Noble found only around 18 base pairs similarities between human endogenous sequences and "HIV" sequences. A few examples will illustrate that this is not the case:"

I have frequently heard the claim that HIV could be endogenous. The usual papers given are from Howard Urnovitz who you have also cited. He claims HIV sequences can be found in the human genome. (1). The evidence he gives is a few sequences of about 18 bps that have a similarity of 89% or greater with human sequences from the Homo Sapiens database at www.ncbi.nlm.nih.gov. As I stated previously similar matches between human sequences and other viruses exist so there is as much evidence that other viruses are endogenous as there is for HIV.

Horwitz et al describe a couple of human sequences that show again small sequences of bps that have a similarity of around 90% to HIV sequences. (2)

The sequences are available online for everybody. (3) If you align them with HIV sequences using BLAST at http://www.hiv.lanl.gov/ you find that there are matches of around 32 bps between EHS-2 and HIV sequences.

AF217180|HIV-1|546MONO46|B|US|-|HIV-1 isolate 546mono-46 from USA, env gene, complete cds. Length = 2641

Score = 42.8 bits (26), Expect = 0.016

Identities = 29/32 (90%)

Strand = Plus / Plus

Query: 1331 cagaaatgggtggagagagagacagagacaga 1362

Sbjct: 2249 cagaagaaggtggagagagagacagagacaga 2280

Similar matches can also be found between the same EHS-2 sequence and other viruses such as herpes simplex virus.

>gi|6572414|emb|Z86099.2|HSV2HG52 Herpes simplex virus type 2 (strain HG52), complete genome Length = 154746

Score = 32.2 bits (16), Expect = 88

Identities = 28/32 (87%)

Strand = Plus / Minus

Query: 1333 gaaatgggtggagagagagacagagacagaga 1364

Sbjct: 120065 gaaatgtgaggagagcgagacagagagagaga 120034

The matches are interesting but nobody is claiming (except for Stefan Lanka) that herpes simplex does not exist.

None of the other references that you have given gave any evidence that extensive sequence similarities exist between the HIV and human genomes. If you have some evidence to support your claims please provide them. Some sequences and alignments would be sufficient.

Eleni Papadopulos-Eleopulos writes: " As far as experiments are concerned the Perth Group has repeatedly proposed the need for experiments as well as actual experiments. Regrettably both lack of money and obstruction by our protagonist colleagues and others have so far prevented these from taking place."

It seems that the "HIV Dissidents" do have money at least $100,000 (4). However it is much easier to sit back and demand that everybody must "prove" that HIV exists, especially when you set yourself up as the sole judge of what that "proof" is. It is far more difficult to buy a few reagents and cell lines and produce evidence for your claims.

This is not the way that science works. There is no such thing as absolute 'proof' in science. Rather there is evidence and in the case of HIV enough evidence to convince 99.9999% of scientists that HIV exists and causes AIDS. Science does not proceed by a few individuals saying:

"Electrons are just a metaphor for a lot of quasi-related phenomena. No one has ever proved its existence as a particle. We don't believe they exist".

Such people are ignored.

Likewise, I predict that you will be ignored.

(1) Urnovitz HB, Sturge JC, Gottfried TD, Murphy WH. Urine antibody tests: new insights into the dynamics of HIV-1 infection. Clin Chem. 45, 1999, 1602-13

(2) Horwitz MS, Boyce-Jacino MT, Faras A. (1992) Novel human endogenous sequences related to human immunodeficiency virus type 1. J Virol 66:2170- 2179.

(3) http://www.ncbi.nlm.nih.gov:80/entrez/qu ery.fcgi?cmd=Retrieve&db=nucl eotide&list_uids=181990&dopt=Ge nBank&term=M86246&qty=1 http://www.ncbi.nlm.nih.gov:80/entrez/quer y.fcgi?cmd=Retrieve&db=nucleotid e&list_uids=181988&dopt=GenBan k&term=M85292&qty=1

(4) http://www.whale.to/a/hiv.html

Competing interests: None declared