Re: Politics vs. science. 7 August 2003
Previous Rapid Response Next Rapid Response Top
Christopher J Noble,
postdoctoral fellow
Bern Switzerland

Send response to journal:
Re: Re: Politics vs. science.

Eleni Papadopulos-Eleopulos writes (Note that the papilloma virus is a DNA virus yet according to Christopher Noble the human papilloma virus' genome is even more variable than the "HIV" genome, an RNA genome).

Please do not twist my words. I stated quite clearly that different isolates of HPV show similar levels of divergence to HIV. At no time did I claim that the mutation rates or evolution rates were comparable. In fact, I specifically stated the opposite. Indeed you previously stated that you were not interested in evolution rates. Why have you changed your mind? Just to refresh your memory. "Neither are we interested in the genomic variation with time, that is, evolution of the genome, but the genomic variation at a given time."

You also claimed that the reference I provided regarding HPV (1) was not available in any Australian library. In fact it is. (2) I suggest you read it before proceeding any further. You also completely ignore the further reference I gave for the diversity of HPV. (3) "The overall nucleotide homology to other sequenced HPV types is below 50%. The closest other HPV type is represented by HPV-18, sharing 49% identical nucleotides."

Please address these points before changing the subject.

You have repeatedly claimed that "the genomes of the most variable RNA viruses do not differ by more than 1%". I will ask you once more to provide evidence for this claim.

You also quote Korber et al (4) "A phylogenetic tree of HA sequences sampled world-wide in 1996 shows much less diversity than a sampling of subtype B HIV-1 envelope sequences from a single city, Amsterdam in 1990-1991."

You forgot to also quote " Tree based on 96 HA1 domain sequences of human influenza H3N2 viruse".

You have previously compared the most divergent HIV isolate HIV-1 group O. You should therefore compare H3N2 isolates and H1N1 isolates form the same year. Please go to the influenza sequence database http://www.flu.lanl.gov/search/ . Search for all sequences of hemagglutinin from human influenza viruses isolated in 1996. Pick one influenza A H1N1 isolate such as A/Aichi/25/96 (5)

ATGAAAGCAAAACTACTAGTCCTGTTGTGTGCATTTACAGCTACATATGCAGACACAATATGTATAGGCTACCAT

BR>GCAAACAACTCAACCGACACTGTTGACACAGTACTTGAGAAGAACGTGACAGTGACACACTCTGTCAACCTACTT

BRGAGGACAGTCACAACGGAAAACTATGCCGACTAAAAGGAACAGCCCCACTACAATTGGGTAATTGCAGCGTTGCC

GGATGGATCTTAGGAAACCCAGAATGCGAATCACTGTTTTCTAAGGAATCATGGTCCTACATTGCAGAAACACCA

AACCCTGAGAATGGAACATGTTACCCAGGGTATTTTGCCAACTATGAGGAACTGAGGGAGCAATTGAGCTCAGTA

TCATCATTCGAGAGATTCGAAATATTCCCCAAGGAAAGCTCATGGCCCAACCACACCGTAAGCAAAGGAGTGACG

ACATCATGCTCCCATAATGGGAAAAGCAGTTTTTACAAAAATTTGCTATGGCTGACGGAAAAGAATGGGTTGTAC

CCAAATCTGAGCAAGTCCTATGTAAACAACAAGGAGAAAGAAGTCCTTGTACTATGGGGTGTTCATCACCCGTCT

AACATAGGGGACCAAAGGGCCATCTATCATACAGAAAATGCTTATGTCTCTGTGGTGTCTTCACATTATAGCAGA

AGATTCACCCCAGAAATAACAAAAAGACCCAAAGTAAGAGATCAAGAAGGGAGAATTAACTACTACTGGACTCTG

CTGGAACCCGGGGACACAATAATGTTTGAGGCAAATGGAAACCTAATAGTGCCATGGTACGCTTTCGCACTGAGT

AGAGGCTTTGGGTCAGGAATCATCACCTCAAATGCATCAATGGGTGAATGTGATGCTAAGTGTCAAACACCCCAA

GGAGCTATAAACAGTAGTCTTCCTTTCCAGAATGTACACCCAGTCACAATAGGAGAGTGTCCCAAGTATGTCAGG

AGTACAAAATTAAGGATGGCTACAGGACTAAGAGACATCCCATCCATTCAATCTAGA

And one influenza A H3N2 isolate such as A/Alaska/2/96 (6)

CAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTA

GTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGA

ATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCAT

TGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTAT

GATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGAACCCTGGAGTTTACCAATGAAGGCTTC

AATTGGACTGGAGTCGCTCAGGATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGA

TTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGAC

AAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGG

AGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGT

ATCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAAT

CTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGAC

AACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATC

ACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAG

AAACAAACTAGA

And one inflenza B isolate such as B/Alaska/12/96 (7)

ATGAAGGCAATAATTGTACTACTCATGGTAGTAACATCCAATGCAGATCGAATCTGCACTGGGATAACATCGTCA

AACTCACCTCATGTGGTCAAAACAGCTACTCAAGGGGAGGTCAATGTGACTGGTGTGATACCACTGACAACAACA

CCAACAAAATCTCATTTTGCAAATCTCAAAGGAACAAAGACCAGAGGGAAACTATGCCCAACCTGTCTCAACTGC

ACAGATCTGGATGTGGCCTTGGGCAGACCAATGTGTGTGGGGATCACACCTTCGGCAAAAGCTTCAATACTTCAC

GAAGTCAGACCTGTCACATCCGGATGCTTTCCTATAATGCACGACAGAACAAAAATCAGACAGCTACCCAATCTT

CTCAGAGGATATGAAAAAATCAGATTATCAACCCAGAACGTTATCAACGCAGAAAAGGCACCAGGAGGACCCTAC

AGACTTGGAACCTCAGGATCTTGCCCTAACGCTACCAGTAGAAGCGGATTTTTCGCAACAATGGCTTGGGCTGTC

CCAAGGGACAACAACAAAACAGCAACGAACCCACTAACAGTAGAAGTACCATACATCTGTACAAAAGAAGAAGAC

CAAATTACTGTTTGGGGGTTCCATTCTGATACCAAAACCCAAATGAAAAACCTCTATGGAGACTCAAATCCTCAA

AAGTTCACCTCATCTGCTAATGGAGTAACCACACATTATGTTTCTCAGATTGGCGGCTTCCCGGATCAAACAGAA

GACGGAGGGCTACCACAAAGCGGCAGAATTGTTGTTGATTACATGGTGCAAAAACCTGGGAAAACAGGAACAATT

GTCTATCAAAGAGGTATTTTGTTGCCTCAAAAGGTGTGGTGCGCGAGTGGCAGGAGCAAAGTAATAAAAGGGTCC

TTGCCTTTAATTGGTGAAGCAGATTGCCTTCACGAAAAATACGGTGGATTAAACAAAAGCAAGCCTTACTACACA

GGAGAACATGCAAAAGCCATAGGAAATTGCCCAATATGGGTGAAAACACCTTTGAAGCTTGCCAATGGAACCAAA

TATAGACCTCCTGCAAAACTATTAAAGGAAAGG

Now try to align the sequences. Do you you get 1% differences or more than 50%? How many sites are conserved? Now tell the difference between these isolates with electron microscopy.

Let's go back to your original argument for dismissing thousands of papers describing the HIV genome.

'In other words, if a mere difference of less than 2% leads to the appearance of two totally different objects (namely, humans and chimpanzees), how then can differences of up to 40% lead to the appearance of the same object'.

According to your argument neither HPV nor influenza exists because divergent isolates show differences of much more than 2%. Will you deny the existence of HPV and influenza or will you admit that your previous arguments were deceptive and misleading.

1. Halpern, A., Journal of Clinical Virology 19 (2000) 43-56

2. http://catalogue.library.uwa.edu.au/searc h~/t?SEARCH=journal+of+clinical+virology&searchscope=3

3. Hirt L, Hirsch-Behnam A, de Villiers EM., Virus. Res. 18 (1991) 179-89 http://www.ncbi.nlm.nih.gov:80/entrez/ query.fcgi?cmd=Retrieve&db=Pub Med&list_uids=1645904&dopt=Abstract

4. Korber B, Gaschen B, Yusim K, Thakallapally R, Kesmir C, Detours V. (2001). Evolutionary and immunological implications of contemporary HIV-1 variation. British Medical Bulletin 58: 19-42

5. http://www.flu.lanl.gov/search/view_record.ht ml?accession=AB043493&database=fluA

6. http://www.flu.lanl.gov/search/view_record.ht ml?accession=AF008723&database=fluA

7. http://www.flu.lanl.gov/search/view_record.h tml?accession=AF050060&database=fluB

Competing interests:   None declared